Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb16h1
Clone ID PSTVUpb16h1
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb16h1
Sequence
AGAACAAACCTGTGATGGCTTTTGGATTGGTAACCCTTTCACTTTGTGTGGCTACATTGGTTATCTGCATGCAACTCAAG
AGAACAGAAAGGACCTCTATGAAGCCATTGACAGTGAAGGGCATCGGTACATGAGGAGAAAAACATCTAAGTGGGACTAA
CTGCTGCTTCCTTCAGGTGGAGTGTTATTATAGGCTCCGACACCTTTGAAAGAAAGACTGTTAGTGCACAGAATTGTTTC
TTGTTCCATAATATGTTAACAAGGGAGAATATAAAATTGAAAGCAGTCCACTGTGGTGAGTTAAGTCTCATTACAGCTGA
AGGCATTAAATTCTGTATAATAAAAGTACCCAGTACTCTTCCATTTGCATGGAGTTTCTAACCGTTTTAGAGTGGATTGT
GCCTTTGCAGCAATGCTTTACTGTTAGGAGAGAAGACACCCCTTCGGTTACTAAAATCATAATTAATGAAGGAATAAACA
AA
Sequence Type mRNA
Unitrap ID UNI19751

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34715913..34716398 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]

 
Come back to gene ENSMUSG00000028295


For any suggestions or comments, please send an email to unitrap@crg.es