Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb16d12
Clone ID PSTVUpb16d12
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb16d12
Sequence
AGGCCCAGGCCTTGTCATGTTCCAGTAAGTTCGAAGCTGAGTTAAAAGCTGAGCAAGAAGAGCGGAAACGGGAGGAGGAG
GCCCGGAGGCTCCGCCAGGCAGCCTTCCGGGAGCTCAAGGCAGCTTTCAGCGCGTAGTCCTGCTGACCTGACCTTTGACC
GCGGCTGTGCCTTACTAACACCCTGGAGGTGATGACCAGGATTTTTCACATTTTTATCCCTGCAGCCCTCTGCTCAGATG
ACCTCCCCTTCACGGCCAGGCCTGTTTCTTAGTGCTTCTGGATAACCAGTAACTTGCTTTCGTCCTTCCAGGGTCCTGGT
CCCTTCCAAACGGTTTGCCAGCCAGCCTTTCCAGCCTTACCCCTCTGCTGTTATCTGTAGATTCGTTTCTTCTTGGAAAC
CTTATTTATCCCTGCGGAGTCCTATGTCAACTCCTGTTCATCTACGGTTCTCAGAGGACATGTTGCCTGCGGCCCCGGGA
GTTTTTCCTTTGTGTTCCTTGAATTGTTTCCTGGCAGCGTCTGTCTGCCTTCTTGTTATTACCCAGATTCCATTGACTTC
TTTTTCACCGTCTTCCACGCTAGTGTGATGATGGGATTTGAAGGAGCACTTGTGGATCAATACCAATATCCCTCCCAACC
AGGGACTAGTTTGATCTATCTTTGCCTGGCTCTTGGCTCTAACAATGCCAACCCTCTTGTCCCCCTCGTCANTTCCNGGN
CNGCCATTTTCCNCTCCTAAGTTCTTACTG
Sequence Type mRNA
Unitrap ID UNI22832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89206234..89206896 629
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026255 (Efhd1) NM_028889 EF hand domain containing 1 Gene [Source:MGI (curated);Acc:Efhd1-001]

 
Come back to gene ENSMUSG00000026255


For any suggestions or comments, please send an email to unitrap@crg.es