Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb15h11
Clone ID PSTVUpb15h11
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb15h11
Sequence
AGCTACAACCATGTTTGAAGCTGGGAAAGACAAGAGCAACCCAGATGAGTTTGCTGTCGCTCTTGACGAGACTCTGGGAG
ACCTTGCCTTTCCTGATGAGTTCCCGTTCGACGTGTGGGGAGCCATCAGTGACATGAAACAAGGAAGATGATGGCGTGGC
CCGTGTTCCTGCAGAGATGACCACAGTTCTGCAGGCAGCCTTCTCCGGGGTCTTAGACACTGTTATGAACTCTACTTTAG
CCTCTTGTGTATGAGATACAGTCTTCGAAATGTAATTTTGATTTATGGATGATGTTTAATATAGTTTCTTATGTAGTGTG
TTTAAGGTAAATTAAAGTGTGATCCATTTTAATATTTGTTCAAAAGCTTTAAAATTTTTAGAGGAATCTTTCTACATAGG
TGATTTTGGCCCTGTTTGTACCCACGGCTCTTTCCACATAAAATACTTGATTACAAAA
Sequence Type mRNA
Unitrap ID UNI12795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151756805..151757261 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039131 (Gipc2) NM_016867 GIPC PDZ domain containing family, member 2 Gene [Source:MGI (curated);Acc:Gipc2-001]

 
Come back to gene ENSMUSG00000039131


For any suggestions or comments, please send an email to unitrap@crg.es