Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb14a6
Clone ID PSTVUpb14a6
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb14a6
Sequence
AGTGATCCTGCTGCATGCTTCACTGCGTCTGAGAAACCTTAAAAACAAGATTGAGAACAAGATCGAGAGCATCGGTCTAA
AGCGGACACCAATGGGATTGCTTCTAGAGGCACTGGGACAGGAGCAGGAAGCTGGATCCTAGGACCTTGGCATCTACACC
CTGGACGTAGAGGACCCCCACCCCATACCCAAGACCAACCCTTTTCCTAGCCATTAAAATAGGTGCCTAGAGTCCTCTGG
CCTGGCCAAAAAGAGACACCTGTGATTGATCACTGCAGCCCCAAACTAGTCATCTCTTAGCCTCCAGCCCCTGTTACCTA
GGGACCAAAGTCTTCCTCGGTCCTGAATTTGAGACTCAGTCACCTACTTCCAGTCTTGAAACTGGACTTTTAAGCCAGAG
CATCTGTGGCCAATCTCAAAACTGGACCCCAAGATACTCCTCTGACCCAAATGTGGGACTCACTAGTCTTCCATACGTCA
AAGCTAGGCCCTAAGGCAGGACATTCTCAAATCTTGAGCTCTAAAGATTTTTCAGACCCCACACAGCTTGGAATATANGT
AANAGACCTGGNCAAATCTTGAGCCTAATGAGTCACACTGAGCCCTTAACCCCAGACGACCCTAGNCCTTAGCAGTCCNA
TAGCCTNCTCCACNGTTAAGAGGGTCTCTTCTCCTCCAGGGTCTCAGTATCAGGACAACATGTGGGCTGGNANGGAAGCC
CACTGGNAAGGACACATATAAAATGTGCACACAATAAGCCTTGAATTCAGC
Sequence Type mRNA
Unitrap ID UNI17677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7307392..7308067 638
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031149 (Praf2) NM_138602 PRA1 domain family 2 Gene [Source:MGI (curated);Acc:Praf2-001]

 
Come back to gene ENSMUSG00000031149


For any suggestions or comments, please send an email to unitrap@crg.es