Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb14f3
Clone ID PSTVUpb14f3
Vector pGTR2.1
Project vanderbilt

Sequence tag PSTVUpb14f3
Sequence
AGCCCATCCTCAGAGGGATTTGGCTCTTGCTCTGAGGGGAGCCTCACAGATTCCAGACGGCCGTGGCAAGTCCAAGCATC
GCGTCTCTACCATGTCCCAGAGCCAGAAGAGAGGCTGTTGTTTGGAAAGGCAAGAAGAATTCCCCAAACTTGGCCAGAAT
TGTATTGTAGACAAGATGGAGGAGGAACAGTTTACAGGAAGGCCTCCAACGCGCCCGCACACAGATGCACTTCCTGTGAA
AGCACTGGTGCAGATGCTCTGAGTGTAAGCAGCCAGTGTCTTGGAGGCATCAGCAACCCTCCTTCATGACCTTATTAATA
AAGTCCAAGATTCCCTTCGCAATTAAGAAGGGAGCNTCTAAA
Sequence Type mRNA
Unitrap ID UNI14108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116529344..116529701 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]

 
Come back to gene ENSMUSG00000075410


For any suggestions or comments, please send an email to unitrap@crg.es