Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb14c1
Clone ID PSTVUpb14c1
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb14c1
Sequence
AGGAATTCACGGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGAGGACCCAGGCTCCAGCTGTGGCTACCACA
TAAGGGTTTTTATATGAGAAAAATAAAAGAATTAAGTCTGCAAA
Sequence Type mRNA
Unitrap ID UNI15131 UNI29317 UNI29318 UNI29319 UNI29320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61418696..61418816 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069367 (AC121903.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24858746..24858866 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044533 (Rps2) NM_008503 ribosomal protein S2 Gene [Source:MGI Symbol;Acc:MGI:105110]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 76092382..76092502 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061833 (AC122242.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60182805..60182925 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066487 (AC153654.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76636457..76636577 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075515 (AC140426.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 63859265..63859385 121
 
EST/CDNA Est Name
  BG917413.1 - BG917418.1 - CJ318524.1 - CB319919.1 - BQ127680.1 - BF138994.1 - BG965570.1 - CB318131.1 - AA617302.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122646818..122646938 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072789 (AC131715.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130128827..130128947 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057244 (AC114657.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35149313..35149433 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082762 (AL831776.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50252564..50252684 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067946 (BX649621.5)  

 
Come back to gene ENSMUSG00000067946


For any suggestions or comments, please send an email to unitrap@crg.es