Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb13f8
Clone ID PSTVUpb13f8
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb13f8
Sequence
AGGGCCTGAAGAAGATATCTGACTACATGAAGAGCAGCCGCTTCCTCTCCAAGCCAATCTTTGCAAAGATGGCCTTTTGG
AACCCAAAGTAGGATTACAAAGCCCAGACCTGGGGGAATACTCATGAGTGCTCTGCTGGCCCTAGCTCTTACCACGTGCA
GCTTTCTTCTCCTTTCCATTCCCTATTCCTCCATTTCCTCTTCCCAGCCCTTCCCTCAGCCAAGCCTCTGGGTCCTTGGG
CTCTCCATTTCTTCATTAGTCTCCTCCTATCCCTTGTCTCTGCCCTGCATCCAGCCCTTCCCTCAGTGATGGTTGGAGGA
ATGTACTAGACCCGAGAATCCCCGGCCTGGCTGAGAGATTAGATCTGCCTGTGTGCTGCCTTGGTCCTCAGAAGTAAGCA
GCTAAGCCCCATTTGGTTCTCAATAAAGTGTGAATCACAAA
Sequence Type mRNA
Unitrap ID UNI29065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107784620..107785058 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040562 (Gstm2) NM_008183 glutathione S-transferase, mu 2 Gene [Source:MGI (curated);Acc:Gstm2-001]

 
Come back to gene ENSMUSG00000040562


For any suggestions or comments, please send an email to unitrap@crg.es