Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb10d11
Clone ID PSTVUpb10d11
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb10d11
Sequence
AGCCAGTGGCCTGGTTGTCCAGATGTCCCCAGCTCAGCACAATGGCCATAGGCAGCATGGAGTGTCATGTCTCTGGCTTC
TACCCAAAACCTGTGTGGGTGATGTGGATGCGGGGTGACCAGGAGCAACAGGGTACTCACAGAGGTGATTTCCTGCCAAA
TGCTGATGAGACATGGCATCTTCAAGCAACCCTGGATGTGGAGGCTGGAGAGGAAGCTGGCCTGGCCTGCAGGGTGAAGC
ACAGCAGCCTAGGAGGACAGGATATCATCCTCTACTGGGATGCCAGGCAAGCACCCGTGGGCCTGATCGTCTTCATAGTA
CTAATCATGCTAGTGGTGGTGGGTGCTGTAGTCTACTATATCTGGAGAAGGAGAAGCGCTTATCAAGACATCCGGTGACT
CTTCCTTACACCTGCCTCTCCTGAAATTCAGACTTTCAGGCTCTAGGACTTCAGTCCTGGTCTGCTCAGGATCTGGGGAT
GAAGGAGAGGAATCCTGAAGAAGTGAAGAGCANCCAGTACGCTCTTTTCACATTAATTATAGAAATTAATTATTTGAGTT
GTTTCGTCCGTTTCCATAGTTTAGAACAAACCCACTTCAAATGTGCGTACCTGCCAAAAACAAGCTTGTTGGCAGTGTTT
TATGGGATTTGCCCTGAACTAGAAAAGCATAACTTCTTGCCCAAACAGACTCTTTTGGGGTTAGNTTGGCAAGTGTAAAA
GTCCAANCCCAACCTGGGGTGGACTCTGTAATTTNCAGGGGA
Sequence Type mRNA
Unitrap ID UNI29321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86800143..86801535 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028076 (Cd1d1) NM_007639 CD1d1 antigen Gene [Source:MGI (curated);Acc:Cd1d1-001]

 
Come back to gene ENSMUSG00000028076


For any suggestions or comments, please send an email to unitrap@crg.es