Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb7h7
Clone ID PSTVUpb7h7
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb7h7
Sequence
AGATCTTTCCCGGTCTTTTCAACCCAGCTCCGTGGCCTGGCACATTCAGGTGGAGACTAGATGGNNGTACATCTTACGAC
GTAGACGAGCTTTGAACCTGCCATTCCCCCTCTCACTTAGGCAAGGTTTGGTCCGTCTTGTGCTTGCTTCTGCGAGGCCA
TGGCTCCACAAGCCTGGGGAGGAAACTCAGCAATCTCTATGAGCTCAGGAGACACAGTGTGAAGCCTTTGCATCCCTCCC
CTCCTGCTTGAGAGCCTGTGTACCAGAGCAGACAGGCAGTGCCTGAGAGCCAGGCTCTGAGACTGTGCCACATAAACTCC
CACTTCTAGCTGTAATCTTGAACATGACGCTTACTTTTATTGTATCTTAGTTTTTCATCTGACAGGCACAATAAAAAAAT
CTTTCCTTCAATTAAA
Sequence Type mRNA
Unitrap ID UNI29322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118626876..118627293 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073765 (OTTMUSG00000008822) predicted gene, OTTMUSG00000008822 Gene [Source:MGI Symbol;Acc:MGI:3651212]

 
Come back to gene ENSMUSG00000073765


For any suggestions or comments, please send an email to unitrap@crg.es