Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC692
Clone ID XC692
Vector pGT1Lxf
Project baygenomics

Sequence tag XC692
Sequence
AGGCTGTGGTAGAACAAAACTGTTCTGGTTGATGGCATTAGCAGATTCTAAAACAATGAAGGCAATGGTGGAATTCCGAG
AACACACAGGCAAACCCACCACGAGTAGCTCGGAAGCATGCCGCTTCTGTGGGTCCAGGAGTGGAACGGAGCTGTCTGCT
GTTGGCAGTGTTTGTTTTGATGCAGACTGCCAGGAATATGCTAAGATCGCCTGCAGTAAGACACATCCCTGCGGACATCC
ATGTGGAGGTGTTAGAAACGAAGAGCACTGCCTGCCCTGTCTGCACGGCTGTGATAAGAGTGCCACCACACTGAAACAAG
ATGCCGATGACATGTGCATGATCTGCTTCACCGAAGCGCTCTTTGCAGCACCGGCCATTCAGTTGGACTGCAGTCATGTA
TTCCACTTGCAGTGCTGTCGGCGAGTTTTGGAAAACAGATGGCTTGGTCCAAGGATAACGTTTGGATTCATTTCGTGTCC
TATTTGCA
Sequence Type mRNA
Unitrap ID UNI10078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103521734..103525927 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]

 
Come back to gene ENSMUSG00000033004


For any suggestions or comments, please send an email to unitrap@crg.es