Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb7a11
Clone ID PSTVUpb7a11
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb7a11
Sequence
AGGAAAGTACGCCCAAGTTACCAACAATCCTGAGAACGATGGGTGCATAAATGCGGTCTTGCTGGTCTGACAGTGACGTC
ACTCATACACGTCATTCCACTCACTGCTGAAGACCACACCCTGTCAGGAAAACACCGTCCCTGGGGTCTTTCTGAACCAC
CGAGCAGCCTTACCTCATGTGCAGTCATCAAGCATTTACTAAGTTGTAAAGGAAAATAAAACTGCCCAGTTTGACAGTTA
Sequence Type mRNA
Unitrap ID UNI29325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97900947..97901185 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060739 (5730427N09Rik) NM_021552 RIKEN cDNA 5730427N09 gene Gene [Source:MGI Symbol;Acc:MGI:1913883]

 
Come back to gene ENSMUSG00000060739


For any suggestions or comments, please send an email to unitrap@crg.es