Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb6h3R1
Clone ID PSTVUpb6h3R1
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb6h3R1
Sequence
AGGTGGGATGTGTGTGGGCTGAAATCCCAAGCTGCGGTTGTGCATGAGAATACACCCTTCGTGGTGCCCCATCTCCGGGA
CGATCTCGGCTCTGTGCATTCAGTCCCCAGGAACCGTGGACCTTAATTTACCTTGTTAAGTACTTTCTCTTTCCTATTCT
CTCTCCTGCTCAATTTCCTGTTCTCCTGTTTGCTCTTCTGTAGCTTCCCCTTTGAGTTCTGCTCTCCCAGCATGCCTCCT
ATGCAGAAACCGGTGGGGCTGNGCTGCTCCTCCCTTCCTCCTGACTGCAGNCAGTGGGTATTGGATTTGGGAGTGACCTT
GTTGAGAATCACTGCTCCTAGTTTTCTATTTTGGCCCAAAGACTAGACTTAGAAATTTGGAGCACCTTCAGTGAAATAAA
TGGTTTTTCAACTT
Sequence Type mRNA
Unitrap ID UNI12904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4785154..4785569 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es