Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb1B2
Clone ID PSTVUpb1B2
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb1B2
Sequence
AGTTCTTCTGAGGNGATCCGTCGAGGACTTCAGGGATTGAAGTGCCATCTCTGCAGACTCTGTGCCGACTAGTGATCCAG
AAGAGGGTGGTACACAGGCTGGCCATTGATGTGCTCCACCTGCCCAAAGGACTGAAGGACTTCTGCAAGTACNAATGAAC
GAATGAACGCCTGTNTGTGGCCACCAGAGCAAAGTCCCCGGTGGTGCGCCCTGCCTCTAGAGAAGTGGCTAGACTGAAGC
TGGTCGNACAGCTNACAATCAGGGCTGGAAATAAATAGAGCCGATGTGGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164656240..164656489 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039873 (Neurl2) NM_001082974 neuralized-like 2 (Drosophila) Gene [Source:MGI (curated);Acc:Neurl2-001]

 
Come back to gene ENSMUSG00000039873


For any suggestions or comments, please send an email to unitrap@crg.es