Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E13
Clone ID E13
Vector LNPAT1
Project vanderbilt

Sequence tag E13
Sequence
GGATATTTTGGAGCCGTTGGAGCACTCCTCGAGCTGTTGAAGATACCCTGACTTACCGAGAGGACTTCCTGAAACCTGCC
ACAGAGACATCTGTGGATTTTTTTGTTTTGTTTTGTTAAGAGACTCAAGTTTTATGATCGTGTACTACTCAAATCANAGC
AAGAAACAAATGTATTTTTCTAAGACATCAAGATAAATTCTTAAAATTTTGTCTAAGGACACCCCATCCCACCCCCGTCT
AGGCAGTATGAGGATTTGCTGTTTATAGGGTATTCTCAGGGCAGCGTTATTAACCCCTGAGGTGCTTTGGAATCCCAGCA
TCACCCACTTGGGCATACGTGGAGCTTTCTGGACTCCCACCAGCAGCTGACTGCTTGTCCTGTTGAAATGTATGTGAGAA
TCTAACCGCTTTCATCAGT
Sequence Type mRNA
Unitrap ID UNI29327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131122009..131122427 417
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037514 (Pank2) NM_153501 pantothenate kinase 2 (Hallervorden-Spatz syndrome) Gene [Source:MGI (curated);Acc:Pank2-001]

 
Come back to gene ENSMUSG00000037514


For any suggestions or comments, please send an email to unitrap@crg.es