Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E12
Clone ID E12
Vector LNPAT1
Project vanderbilt

Sequence tag E12
Sequence
GGATGCCCTGGACGCTCTGGGCCTAAAGCGCTACTGCTGCCGCCGCATGCTGCTAGCACACGTGGACCTGATTGAGAAGC
TGCTGAACTATGCACCCCTAGAGAAGTGACCGCTGGAGCCTGCCCTCCTCTGTCTCCTGCTGGCCACGGGCAGCCTGTCG
TGCTATGTTCAAACTGAGCTATTGGGGATGTTGGTGTATTGCCTGGCTGTGGCCCTGTGGCTAAGTCCTGTTACCCTGGA
AGGAACTGTTTAGTAAAGATGTTTGC
Sequence Type mRNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659038..148659303 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126534933..126535198 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074846 (AL732330.14)  

 
Come back to gene ENSMUSG00000074846


For any suggestions or comments, please send an email to unitrap@crg.es