Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone C66
Clone ID C66
Vector LNPAT1
Project vanderbilt

Sequence tag C66
Sequence
TCTTCCCAGGCCAAGACGCTCATCTCAGCTGCACCATCAATTCCCAGCATGCCACCGCTGGAGATATTGGGGTGTCGTGG
TACCAGCAGCAGCCAGGAAGTGCTCCCCATCTTCTCTACTATTACGCANAAGAGGAACACTATCGGCCCGCTGACATCCC
CGACAGATTCTCAGCTACCGTGGATGCAGCCCACAACGCCTGTATCCTCACCATCAGCCCCGTGCTCCCGGAGGATGATG
CCGATTACTTCTGTTCCATCGCCCACACCTTTGAACCCTAGGGCTGGGTTGAACATCTTCTGTCTCCTAGGTCTGCCCCC
TGACCTTGGGCCTCCTCTTTTTCTCTTAAGTCTTGCTTTCTTTCCTTCCTCTGTGAAATGAGTTAATAACACTCGACGGG
TCAACCACTGTCCTGAGAACTGTGAGATCCTGTGTA
Sequence Type mRNA
Unitrap ID UNI13043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75411927..75412362 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000903 (Vpreb3) NM_009514 pre-B lymphocyte gene 3 Gene [Source:MGI (curated);Acc:Vpreb3-002]

 
Come back to gene ENSMUSG00000000903


For any suggestions or comments, please send an email to unitrap@crg.es