Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU02.PA17-2
Clone ID PSTVU02.PA17-2
Vector U3NeoSV2
Project vanderbilt

Sequence tag PSTVU02.PA17-2
Sequence
AAATTTTTCAAATTNCCGNGTACCCATTAACAAAGGTTCATCCAGTGGATTGAAAAGTAACCNTAGNCCCTTCNTCNTCA
NTNATGTCCAAGCCNAGCATANCCAGATGGCATTCTTTTAAAGGACTCTCTTCATTCTGGCTAATATAGCTATTCGCTAN
TTATATTCTATAAAGATCTGTTTTGGAAAATTAGTCAATTTTTAGTTTGTATAATCTCNGCAGNGCTTTGGGATCCCTAC
TATATACTGTCTTGAAATTGGCATACTTATATTTGTACTCTGGGACTGATGACAAGAATTGGTTTCATGCCATTGAAAGA
TTCATCATAGATGCTTGCCCCGACCCTCCCCAGCCCCCTGTCCAAGATAGACTTTTTTAACTTGTAAAATGTTCCAGTTT
GCTTTTTTTTCCTGGATCATTNTTAGTAATTTGAATTGATTTGTTCAATACTTTGAATACTTCATTTGTTTTAAGCCATC
AGATATATTGGTATAGAGCTATGCAAGATACTGTGTTCACGTTGGGCCTTTTCTCTCCTTTTGTTGCTTTTCTTATGTAT
TTTTTAAAATTTTTTCCTCTTGTCAGTGCATGTGTGTTCCTCTTTCAATGACCCCAGCTCAGGAGTGTGGGGCTTTGTCT
GGTGTCTGAGGTTCTCAGACTCTTCATGCTTGCTGGGAAGCTGCTGCTGCTACGGTTGTTTTTGTTGTTGTATGTGAATA
AGTAGCACAGGTACAGAGTTCTGGGGTAAAACCTTTTTCCTTCTAGAACTTAGGGACATTTTGTATATTGTTTTCNTGCA
GGAAAGACCNCACTTTA
Sequence Type genomic DNA
Unitrap ID UNI14999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68844577..68845308 659
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es