Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU02.H51
Clone ID PSTVU02.H51
Vector U3NeoSV2
Project vanderbilt

Sequence tag PSTVU02.H51
Sequence
GTATACACTGACATGAAAGGATATTCCATTAGATGGAATANAAGAAAAAAAGTTTCANAACAGGCTAAACCAATTCTTGG
TAGGAAAACTATGTCCCTTGCTTAGTTTAACAGTGGCCCCCTTAGTTGCTGCCTGCCTATGGGAAGGCATGTCCTTTGCC
TTCGTGACCTTTCTGACTGTGGTATGGTGACATGGCTTCTCAGAGCTCTCCTCGGTCTCCTCCTTTGTCCCTCAGAGATA
ACAACGTGCTTTCCTGAACTCTTGGTGTGGTAGGCGTGTCTCTGTAGTTTAAAGAGCTTTCCTTTTCACCCCTCAGTTGG
CTCAGGCTCTGCGAGCTCTAGTGGACTGACTGGAAGCTACATTCCTTCCTTTCTGAAAAAGGAAATCGGTTCTGTCATGC
AGAGGGTTCAGCTGGCGCCCCTCGCAGCCCCTCCCCCCGGTGAGTCGCAATTCTTGTCATCGGTAAATTAGTCCAGTAGT
TCCTGAGTTGCTGCTCTGTGGCAGGGACAGGGTCTGCANAGTCAGGCAGCACTCTGTANAGGATGCTAGTGGATTGAGTG
TCAACATATACAAATTCTTGATGTGCATAAATGCTAAGGAGAAAAAAAACCAAANCANGCGAAAAGTGGACTTTGGGGCC
TGGAGCCNACGGAGTCAATAAAGTTTTCTTACAAAAANACTCTTTANTANAANTGGGGCTNAAATTTGTTGNGGCGGAAA
NNTAANTGGNCCAGCNCTTGG
Sequence Type genomic DNA
Unitrap ID UNI14086

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78014401..78015113 657
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009828 (Ick) NM_019987 intestinal cell kinase Gene [Source:MGI (curated);Acc:Ick-004]

 
Come back to gene ENSMUSG00000009828


For any suggestions or comments, please send an email to unitrap@crg.es