Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU02.23L
Clone ID PSTVU02.23L
Vector U3NeoSV2
Project vanderbilt

Sequence tag PSTVU02.23L
Sequence
GCTTCCGNNAAAAGGGCCCCTTNNCCCTTNNNCCCAATTTTAGNNCNTTNGCCTTTTTTCCCNNGNCCGGAGTTGGTGGC
AAGCCCTGCNGTGGGGTGGAAGGGCCTGCATCCCTTGTTCCTGTTACNGTTGAAGACATTTTTCCTNCANATGTCAGTTT
CCCCACCTCCAGATCGACCCCCGGATTCCTCGTGCCAGNAATCCCACTTTTCTTCCATAGACAGCCTGGCTCTNTAGGAA
CTCTGGGAACTTAGCCTTAGGCCATAAACTCGTGTGTGAGCTTTCCGCCATGAGGGCGCCGGGAGCCGTGGAGTCCTGCC
GCTCGGTGCTGATGCCCGGACCCGGCAGGACCGGGCTGAGAGCATTTGTGGGTGCCGCCGTAAGCCGGTGCTACCGGTAG
GGCACCACGCGGCCCTCGGCGGCAGGCACTGCTAGGCAACTAGAGGGGGCCATGCCGTCACCACAACGAAACTTCCCGTT
CCCACATNTCGGGTCTCTTGAAAATGGTGAACGCTAGCAAATGCGGTCACCTCCTTGGCAGCGAGTAATAGTTACTATGG
AGCAGGTAGTTCTGCACGTGTCTAGTCACAAGATACTTGTGGACTCTTTTCTTCTCTGTACCTCAATAAACTTTGGGTGG
CATTTCGTCATGCTCTTTGTATGCGGAGGTGAAACAGGTATAAAATGACCATCTCACTTGCCTGAAGGTCTTAATTTGTT
TATATGGAGGTTACAGATTCTTTTAATCTAAGAATTTTTGCCCTTATTTTTCTAGCCGGNCTNNAGACGGCAANCAATGG
GGGGGGGCGGGGC
Sequence Type genomic DNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127496452..127497177 669
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es