Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC792
Clone ID XC792
Vector pGT1Lxf
Project baygenomics

Sequence tag XC792
Sequence
TCATTAAGGCTCTGCTGACTGCTGTGACCTCCCCACACATTGAAATCCATGAGGGCACCATCCTGCAGACAGTGAGGACC
TGGTACAATATCTATCTGGCCAGCGAAAACCTCATCAATCAAACCACCGCCAAGGCCACCCTTACCCAAATGCTGAATGT
CATCTTCACCCGCATGGAAAACCAAGTGTTACAGGAGGCCAGAGAATTGGAAAAACCAATGCAGTCAAAACCTCAGTCCC
CGGTGATCCAGGCCACAGCAGGCTCTCCCAAGTTCAGCCGCCTGAAGCAGAGCCAGGCCCAGAGCAAACCGACGACTCCT
GAGAAAGCAGAGCTGCCCAATGGGGACCATGCCCAGAGTGGCCTAGGAAAAGTGAGCTTGGAAAATGGAGAAGCTCCCCG
AGAGAGAGGCTCGCCAGTCTCTGGGAGAGCCGAGCCTTCGAGG
Sequence Type mRNA
Unitrap ID UNI9538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166661111..166661956 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es