Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.O9
Clone ID PSTVU01.O9
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.O9
Sequence
TAAGAGCACACAGGAACACACAATTACACACCTTACCCCACGTAGTCAGCTCAATGACAGATCCCAGGAATAGCACACAC
CCCTGAATGTGACAGATCCCAGACACAAATGGGTTCCCTGTGTTAGAACTGTGTGGCCAGTGTGTTCCCTGTGTGGTCAG
TGGCCACCTGGTCCCCACATTCTTAGGCAGGATGTTTGGGC
Sequence Type genomic DNA
Unitrap ID UNI14809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73113010..73113211 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es