Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.J38
Clone ID PSTVU01.J38
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.J38
Sequence
ATTGGATCTACAAATGAGTGTGTATATTGGGTTCTGCAGCTAGCCCTTTTTACTTGACTTCTCAGTTCTGAGTCTAGGAA
ATCTGCGTCTGGATATTTGTATGAGCAGTGGAGGGATTAGTGTTATTTCACTATAAATGATGTTAGTGCAGGTTTTATTC
AACTTCATTTTTCTTTTTAAATAATGGAAGCTCCCCCTGTTCTTCCTCTCTTGTCCTCTCTT
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70334918..70335139 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es