Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HO38
Clone ID PSTVU01.HO38
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HO38
Sequence
CCTGGCTGAGTTCTCGAATTAAAGGCACACACCACCATCTCCTGGCTTGAAAACCTATCTTAGAAAGACTAAAAGCAAGC
TGGGCAAGTGATGAACACCTTTAGTCCCAGAACTTGGGAGGCAGAAGGATCTCTGTGAGTTCAAGACCAGCCTGGCCTAC
AAAGCAAGTTCCAGGACAGCCAGGGCTATTACATAGAG
Sequence Type genomic DNA
Unitrap ID UNI14969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5290622..5290816 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es