Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HN11
Clone ID PSTVU01.HN11
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HN11
Sequence
ACCCGTCGTATTGAGAAAGGCTTTTGTCAGGATGAATCTATATACAAGGCTGAAACCAGAGTAGAAGCAAAGATGGTGCC
TGATACTTCAACACCCACTGCTCAGAGCAATGCTGAAAGTAAGTCTCTTTGAGATTAAAATAAACAATTACTTGTTCACA
TGATAATTGATTGACTGGGGATGTAGCTTAGTGGGAAAGCTTTTGTCTTGCAAGCCCAGGAACTCAGTCTTAAACACCAA
GGAAAAAGTGAAGGAGTTGATTTGTTAACAGGACCATAGGAATATAGTAGGNACTTTATTTTCTCCCTT
Sequence Type genomic DNA
Unitrap ID UNI18348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103217450..103217751 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]

 
Come back to gene ENSMUSG00000032555


For any suggestions or comments, please send an email to unitrap@crg.es