Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC898
Clone ID XC898
Vector pGT1Lxf
Project baygenomics

Sequence tag XC898
Sequence
TGAGTGGCTTGCTGCTTTTCCGCCCTCCGAGATGGCGCTGGACCCCG
Sequence Type mRNA
Unitrap ID UNI6807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118059138..118059184 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039163 (Cmc1) NM_026442 COX assembly mitochondrial protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915149]

 
Come back to gene ENSMUSG00000039163


For any suggestions or comments, please send an email to unitrap@crg.es