Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HM41
Clone ID PSTVU01.HM41
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HM41
Sequence
AAATCCACCTGCCTCTGCCTCTGCCTCCCCAAATGCTGAAGATTAAAGGTGTTCATGCGCCACCATGCCTGGTCGCCATG
CAGAGTTTTAACACGTCACATTTTGTTTCTGCTTCTGGAGACGTGGGCTGGGTGGGGGAGGCCGGGACATGGGGTTCTTC
TCCCCTGTGGAGACCTGGGCCAGGAAG
Sequence Type genomic DNA
Unitrap ID UNI14730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106526167..106526350 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es