Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HL22
Clone ID PSTVU01.HL22
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HL22
Sequence
AAACTGGACTCGTGGCCCAAGACTCAGGTCCAGAGGGTCAGGCAGAGCAATTTTGAGTTTGAGGTGAAGAGGAGGGAGAA
AAGAAGGTTACAGGAACTAAAAAATGTGAGTGTGGGTCAATTTAAGCTACCATACAGGAAATCTCAAGGATGAGATGGGA
TCTTGGGCTTGTAATAAGATGGAGAC
Sequence Type genomic DNA
Unitrap ID UNI14752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13622484..13622664 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005575 (Ube2m) NM_145578 ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene [Source:MGI (curated);Acc:Ube2m-001]

 
Come back to gene ENSMUSG00000005575


For any suggestions or comments, please send an email to unitrap@crg.es