Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HJ46
Clone ID PSTVU01.HJ46
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HJ46
Sequence
TTATCTCCTAGGCTTGCTCCAGCCCTTTGTCCTGCCTGAATGCTGGTGTCTTTTCTCTCCCTGCACTGCCTGCTTTGTGT
GTGTGTGTGTTCCTCTCTCTGCCTGTGTTCTTTCTGTTTGCTTTGTAACTGCCTTTAGTTCTTTTTCTGTTTCCATTCTT
GGATTCTAGAAATCCTCACCATATAAGTCTAGGATACAAGCCCCACCTCCAGCCCCCTCCAGACATTCATGGTGAATCAA
GGGAGACAGTTTTCCATAGGTAACAGCACAACACAGCCATCATCATCACCACCACCACCATCACTATCATCATTATTTAG
ACAACATCACTTTGTAG
Sequence Type genomic DNA
Unitrap ID UNI21745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7390118..7390446 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]

 
Come back to gene ENSMUSG00000031153


For any suggestions or comments, please send an email to unitrap@crg.es