Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HE8Q
Clone ID PSTVU01.HE8Q
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HE8Q
Sequence
CTGTAGCACTGTAGCACTCCTAAGTGCCTACATAAGGCGGTAATGGCTCCACCCAGAATATGTTCTGACCTCGACCAGGT
TCTAGGGAT
Sequence Type genomic DNA
Unitrap ID UNI29342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25706499..25706586 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es