Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HE60U
Clone ID PSTVU01.HE60U
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HE60U
Sequence
TTTTTTAACAGCAGTCGAGGTTAGTGAGGATCGCGAGGGAGACACTTTGCTGTGTTCAAATCCAAGTCAAGGTAGGTGCA
GGAGGTAGGGTCATCAGGTAAAGTCGAGGATGCTTAACTAATACAGATTTTACAGATGAGAAATTAATTTGGGGGGCACT
TTTCATGTTATTTAAGCTAAACCGTTTTTAGAATCTGAAACTAAAATGTGACTGAGTGGTGTGGGTTTTTTTTTTTGTTG
TTGTTTTGTTTTTATAACCCCTAAT
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98625822..98626085 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es