Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.HE33T
Clone ID PSTVU01.HE33T
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.HE33T
Sequence
TTTCCTCCAGGTTAGCCTATTTCACTCTCAAATAGTATCTTTAATCACCTTGAAGCCATGAAGCAGCCTCAGCCATAGCC
CTCAGCTGCTGCCTCCTTCCTGGACAGGCTGTAGCCTGGTGCAGTTTACTTGATCATTCGAGTCTCACATCTCTATTTCT
GTGGAGGAAGACAGTAATTCAAGAGCATGCCTTCTAGAGGCGCAGGCCCTCAGGATAAACC
Sequence Type genomic DNA
Unitrap ID UNI29343

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31427123..31427347 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036733 (Rbm42) NP_598454 RNA binding motif protein 42 Gene [Source:MGI Symbol;Acc:MGI:1915285]

 
Come back to gene ENSMUSG00000036733


For any suggestions or comments, please send an email to unitrap@crg.es