Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC302
Clone ID XC302
Vector pGT1Lxf
Project baygenomics

Sequence tag XC302
Sequence
TACGGCCCCTGGGAGCCCTCCTTCGGTTGCTCCTAGGTCCTTACCTCCTCCTCCGAGCCAGCCACCTGCCAAGCATTTCC
CTCCAGGCTTTCAGCTGTCGAAACTCACCCGTCCAGGTCTGTGGACAAAGACCACTGCGAGATTTTCAAAGAAACAACCT
AAGAACCAGTGTCCAACCGACACTGTGAATCCAGTGGCACGGATGCCCACTTCACAGATGGAGAAGCTGAGGCTCAGAAA
GGATGTCAAAGTCTTTAGTGAAGATGGGACCAGCAAAGTGGTGGAGATTCTAACCGACATGACAGCCAGGGACCTGTGCC
AGCTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGCTGGACTCTGGTGGAACACCACCCACAACTGGGATT
Sequence Type mRNA
Unitrap ID UNI10095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11851508..11867608 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es