Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.H24D
Clone ID PSTVU01.H24D
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.H24D
Sequence
TTTGCGATTTGCTCCAGAAGTTCATAAAATTGACAAGAATCATCTCTGAAGTGAATTGATAGTAGTGAACAAATTCAACG
AGCTACTAAAAGCCCCAGCCATTTCTTCAGTATTTTGGGCAAACGGATTATATAAGTGGTTAAAGCATTTCATCTGGTGT
TATTTTTGTCTCTTTCCCCTCTCCTGTTTGTGTTCTTCAGCCAAAACGTAAGATATGTTTGATTTGTGTACCAAGTAGTT
TCAGCAGTTTCAAATTACTGTTTAAATATTGCTGAAGTTTTGTGGCAGTTCTTTTTACCTTTATTAAAAGTTTTAGTAAT
TTTTGACTTCAGCTTTTTTCATATTAC
Sequence Type genomic DNA
Unitrap ID UNI23500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112278128..112278470 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es