Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.H21D
Clone ID PSTVU01.H21D
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.H21D
Sequence
CAAATAGTGCCTTGAAATGATAGGCTATCTACATGTTTTAGATTGTAGATGCCTGTTACTTTGATTCATGAAATGCCAAG
CTACACATTTGTGTTTGTGGTCCAGCAATTATCTCTATAAAAGCAGTGACATGGCATGTGGAAGCTAGTTTTTACTGGGC
TTTTGTTTTGATTTTTTTTTTTTTTAATAGAGTTTCTCAATTTTTTTCAATGGTTTGGTCATGTCGAGTTTGGGGCATTA
TAGGTGTTTTCTCCCCTGGAATAAAACGGAAGATTAAAACATGGCTTATATTACATATTAGTTAATGTTTCTCACTCAGT
AGCCTTCTGCTTCATAGGTGCAGC
Sequence Type genomic DNA
Unitrap ID UNI15164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121783279..121783622 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es