Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.H14D
Clone ID PSTVU01.H14D
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.H14D
Sequence
TTTTTTTTAAGGACAGGTTCTCTGTGTAAGGCCTGGTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGTACTCAG
AAATCCTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCACCACTGCCCGGCTTGAAACATAAATTTTAAAAA
TACTTTAATTTTGATTATGTGCCTGTGTGTATATGAATGTAAATGCAGTGCCCAAAAGAGGTCTGAAGGTGTCAGATCTT
CTACAGGTTGTTGTGAGTCAAAGCAATGTATGCTTCTAACTGATAAACCATCTCTCTAGCCTCCTTTGCCTATCTTTTCC
TTTATTTTTTATTTTATTTTACTTT
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108500911..108501259 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es