Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.F26
Clone ID PSTVU01.F26
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.F26
Sequence
CCTTAGTATTGGTACTACATTTATATCTGGGGTGGGCCTAGTCTGGGAGCTGATAGTAGGTTTCAGCCTCTACATAGTGT
AGCTCTGTTACCCAGTCTTCTATGTCTTGCATCTGTCTTCTGCACCTCTGAACTTAACCATCCTGCTTCCACTTTGCCTT
TCAAGTTCTGAGTGGACTCTATCAGCTGGCTCTAGTCACCACCAGGCTTAAGACGTCTCTGTGTCCTCTCAGTTCTGGAT
CCCTCGGCTACCCACTTTACATGGGTTAGGTAAAGTCTGCGAAGCATCTCTTCTCATCCCTCTTAGATCCTCAGCACACC
AGAAAACTAT
Sequence Type genomic DNA
Unitrap ID UNI14847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107826009..107826345 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014859 (E2f4) NM_148952 E2F transcription factor 4 Gene [Source:MGI Symbol;Acc:MGI:103012]

 
Come back to gene ENSMUSG00000014859


For any suggestions or comments, please send an email to unitrap@crg.es