Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.E6KR
Clone ID PSTVU01.E6KR
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.E6KR
Sequence
CTCCTGCNGTCAAGTGTGTGTTACAAAGTCTGGTTAGCGGTGGAGCCAACTCTGTCTCTCCCAGTCTGGTGTTCCGTTTC
TTATGTCATGAGTCTCTTTGTTAACTCTTCTTTCGGACAAAGGTTTCACAGTTTAGGGAAGAATAGGACGGGTGTAGGGA
TCGACGAGAAGTGACGAGTCCATTCGTGACTGATGAGNTTTTCCGGTTTTTTTGTTGTCCCCTCTCCCAG
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379825..35380057 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es