Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.E415
Clone ID PSTVU01.E415
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.E415
Sequence
TTGGTAGTTGGGAATACACTGTGCGAGTAGCAGCTGTCTGGGTTGGTAGTTGGGAATACACTGTGGCGAGCAGCAGCTGT
CTGGGTTGGTAGTTGGGAATACACTGTGGCGAGCAGCAGCTGCATGGGTT
Sequence Type genomic DNA
Unitrap ID UNI14985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32348648..32348778 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es