Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.E413
Clone ID PSTVU01.E413
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.E413
Sequence
CCCTCTTTTGTTTTTTTGAGACAGAGTTTCTCTGTGTAGGCCTGGCNGTCCCAGAACTCACTCTGTGGACCAGTCTGGCC
TNAAACTCAGAAATCCACCTGGTTCTGCCTCCCAAGTGCTGGATTAAAGGTGTGGACATCACTTCCCAGCAGAGCATCAA
CTCTTATAT
Sequence Type genomic DNA
Unitrap ID UNI5805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106532754..106532925 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es