Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.E2E
Clone ID PSTVU01.E2E
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.E2E
Sequence
ATAGTGAGTCGTTCCTGGTCCTAGATGGGCATCAGGAGCTGGACAGACACTGTAAGGACAAGGACAGGAGAGTCCTTTAA
AAAAAAAAAAAAAAAGGAATGACTTATTTCTTTTATGTATTGTGAGTAC
Sequence Type genomic DNA
Unitrap ID UNI29348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27058376..27058504 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]

 
Come back to gene ENSMUSG00000024301


For any suggestions or comments, please send an email to unitrap@crg.es