Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.E20CR
Clone ID PSTVU01.E20CR
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.E20CR
Sequence
GCGCNGCNCTTTGATGTACCATTTCTAATTTCCTTTTNNNCCCCCGGAAAGGAATTCAGGTTCTTGTCTTGTCTGTGGAG
GTCTTTTCTAGGAGGGAATCCAAGGAATCTCTTTTGAAACNTTTTTTTATTTGGTTAGTGATTTAGTCATTTTATTCAAG
AGTTCAAAAGTCTGTGTAGAAATTATTCAAACATAATTGAAGATGAATCATTTGTGAACTTTACTGTTTCTCTCTTTTTT
TTTTAAAGATTTATTTATTATATGTAAGTATACTG
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91571441..91571660 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es