Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVU01.5A2
Clone ID PSTVU01.5A2
Vector U3NeoSV1
Project vanderbilt

Sequence tag PSTVU01.5A2
Sequence
CTGAGCTGACGAATTAAAGGCGGACCCGTACTGATTACACCTTCCTCCTTTTGTGTTCCTTTTACCCCAGGTTGAATTTT
CTCGGAGAAAGACAGGCCGGCCATCAGGAAAACAAACAAGCCTCAGCAACATCTAAACCCTTGAAAGGATCCTGAGAGGG
GGGAAAGGGAAATCAGCCACCAGCCCAACCACTCGTGTCTTCTGCCCCTCCCCACC
Sequence Type genomic DNA
Unitrap ID UNI2151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054087..36054288 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es