Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-B135
Clone ID Ayu21-B135
Vector pU-17
Project egtc

Sequence tag Ayu21-B135
Sequence
CGAGCGCGCGGCCTGCGGTCAGCGGCCCATCGGCCGAAAAGATGGTGTCCTGGATGATCTCCCGAGCCGTGGTG
Sequence Type mRNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66559537..66559609 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es