Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T149
Clone ID Ayu21-T149
Vector pU-17
Project egtc

Sequence tag Ayu21-T149
Sequence
AAGCTACGAAGCAGGGTACAGATCGGCGTGGTGGGTGGCTCTGACTACTCTAAGATCGCCGAGCAGCTGGGAGAGGGGGA
CGAAGTCATTGAGAAGTTTGACTACGTGTTTGCTGAGAATGGGACAGTGCAGTATAAACACGGACGGCTACTCTCCAAAC
AGACGATCCAGAACCACCTGGGGGAGGAGCTCCTGCAGGACTTGATCAACTTCTGCCTTAGCTACATGGCCCTGCTCAGA
CTGCCCAAGAAGCG
Sequence Type mRNA
Unitrap ID UNI21586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81786599..81788307 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022474 (Pmm1) NM_013872 phosphomannomutase 1 Gene [Source:MGI (curated);Acc:Pmm1-001]

 
Come back to gene ENSMUSG00000022474


For any suggestions or comments, please send an email to unitrap@crg.es