Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T3
Clone ID Ayu21-T3
Vector pU-17
Project egtc

Sequence tag Ayu21-T3
Sequence
AGTACTGACATACATGCAAGGCTCGTGTGCTTTATCAAAGCTGCTGTGTTGCTAATCCAGAACTGTTCCAGTCTCTTGGC
CTATCACCATGGCTTCAGTTTGGAAGCGACTGCAGCGTGTGGGAAAACATGCATCCAAGTTCCAGTTTGTGGCCTCCTAC
CAGGAGCTGATGGTTGAATGTACAAAGAAATG
Sequence Type mRNA
Unitrap ID UNI29361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22185491..22185682 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042302 (Ehbp1) NM_153078 EH domain binding protein 1 Gene [Source:MGI (curated);Acc:Ehbp1-001]

 
Come back to gene ENSMUSG00000042302


For any suggestions or comments, please send an email to unitrap@crg.es