Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T78
Clone ID Ayu21-T78
Vector pU-17
Project egtc

Sequence tag Ayu21-T78
Sequence
GACTCCGCGCCCCCGAGTAGTAAGTAGTTGTGTCAGTGCTCGGTGGAGGCGGCCGCGATCANCCAGAAGGGGGACGGGAC
AGGAGGCAATGNTNAAATATCGCAAACGGGCTTTGTGTTCCCNTCAAGGTAACGGGGGCAGGGTTGCCCACGTACCCTCC
GGTCCCTTTCCCACACGGCGCTGGCTTATGGGGCCAGGGTCGCCGAGAGGTGTCTGTCCAACCCAGGACTTATGCGCTAG
ATGTTTCTTGGTAGCTTGCCTAGAAAACCCAAGTAAACATCGGTACTTTCAGAATATAGGAATGAGAGGCAAGGAAGAAA
GGACATTCATCATACGAAGATTTGAATCACTTTGAAACTGTAAAGGGATGTAGCACTTGCTGCCAAACTACCTTGCTCAC
CAGAATGAAGGAAGTGCTTCAGCATTAAAG
Sequence Type mRNA
Unitrap ID UNI29362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 56166472..56265871 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074305 (C230081A13Rik) NP_766512 RIKEN cDNA C230081A13 gene Gene [Source:MGI Symbol;Acc:MGI:2442366]

 
Come back to gene ENSMUSG00000074305


For any suggestions or comments, please send an email to unitrap@crg.es