Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T79
Clone ID Ayu21-T79
Vector pU-17
Project egtc

Sequence tag Ayu21-T79
Sequence
GGCATGAAAGTGACCGTGTTCTTCGGGAGGACCCGGGTGTTCGTGCCGTGCGGAGATGGCCGCATGAAAGTTTTCAGCCT
CATCCAGCAGGCGGTGACCCGCTACCGGAAGGCCGTGGCCAAG
Sequence Type mRNA
Unitrap ID UNI29364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129588251..129588373 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es