Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T93
Clone ID Ayu21-T93
Vector pU-17
Project egtc

Sequence tag Ayu21-T93
Sequence
ATATACACGTCGGCGTCAGCGTCTCGTCACGTCCGCGTCGACCAGGTCCAGCGGAGACGGGAACAAGATGGCGATCCCGN
TCAGGCA
Sequence Type mRNA
Unitrap ID UNI26111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76891881..76891966 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es