Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T72
Clone ID Ayu21-T72
Vector pU-17
Project egtc

Sequence tag Ayu21-T72
Sequence
TCCCGGGGGGCCATCCGCCCGANTGCCCCTGANTCCGGCAGCGGGGACCCCCCATGGCAGTGGGCACCTCCCCTTGAAAC
CTGCCAAGCTGGACGCCACAGCCCTGCACGACGACACCTCGGCCAGCTCCACGCCCATCTCTGAGGCTTGCAGCCATGCG
GTCCTCGCCTGCGGCCCGGGCATCCCTGAAGAGTACTATGTGAGCGAGGCTGTGGAAGATGCTCCCAGCTACAGAGAGCA
CCGGGATGCNTGCACCATCACCG
Sequence Type mRNA
Unitrap ID UNI6485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121273155..121273417 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es