Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T17
Clone ID Ayu21-T17
Vector pU-17
Project egtc

Sequence tag Ayu21-T17
Sequence
CCCCTCCCGAGAGGAGGGTGGAGCGGCAGCGGCGGCAGAAATGATGGAAGAACTGCATAGCCTGGACCCACGAAGGCAGG
AATTACTAGAGGCCAGGTTCACTGGAGTTGGTGTAAGTAAG
Sequence Type mRNA
Unitrap ID UNI29370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105043328..105045608 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es